Stem-loop sequence pxy-mir-8504

AccessionMI0027309 (change log)
DescriptionPlutella xylostella miR-8504 stem-loop
Stem-loop
   aua  u           cu                uu      g   c    ga   g   u  cgg    -   a 
5'    ca guauacagggu  ccgugcaaguauggau  aaugaa ggg ugac  agg acu gu   uuuc cca a
      || |||||||||||  ||||||||||||||||  |||||| ||| ||||  ||| ||| ||   |||| |||  
3'    gu cauauguccua  ggcauguucauaccua  uuacuu cuc auug  ucc uga ca   aagg ggu g
   gca  c           ug                cc      a   a    ag   a   -  --a    u   u 
Get sequence
Deep sequencing
24 reads, 625 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_98: 791835-791984 [-]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8504
pxy-mir-8526scaffold_98: 797006-797200 [-]
pxy-mir-8504scaffold_98: 791835-791984 [-]
pxy-mir-8520scaffold_98: 782739-782833 [-]
Database links

Mature sequence pxy-miR-8504

Accession MIMAT0033716
Sequence

114 - 

ccauccauacuuguacgggu

 - 133

Get sequence
Evidence experimental; Illumina [1]

References

1