Stem-loop sequence pxy-mir-2a

AccessionMI0027310 (change log)
DescriptionPlutella xylostella miR-2a stem-loop
Gene family MIPF0000049; mir-2
Literature search

2 open access papers mention pxy-mir-2a
(5 sentences)

Stem-loop
   aua ug    c       g         -        cu    ucuu 
5'    u  aauc ggugaag cagcaaagc ggcuguga  uaug    c
      |  |||| ||||||| ||||||||| ||||||||  ||||     
3'    a  uuag ucauuuc guuguuucg ccgacacu  auac    c
   uua gu    -       a         a        --    uaua 
Get sequence
Deep sequencing
490 reads, 1.3e+04 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_168: 3771-3862 [-]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-2a
pxy-mir-2bscaffold_168: 4436-4564 [-]
pxy-mir-2ascaffold_168: 3771-3862 [-]
Database links

Mature sequence pxy-miR-2a-5p

Accession MIMAT0033717
Sequence

19 - 

gcagcaaagcggcugugacuuaug

 - 42

Get sequence
Deep sequencing384 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-2a-3p

Accession MIMAT0033718
Sequence

55 - 

uaucacagccagcuuuguugacu

 - 77

Get sequence
Deep sequencing106 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1