Stem-loop sequence pxy-mir-965

AccessionMI0027311 (change log)
DescriptionPlutella xylostella miR-965 stem-loop
Gene family MIPF0000708; mir-965
Literature search

1 open access papers mention pxy-mir-965
(1 sentences)

Stem-loop
   auc                 -          u    ----   -       
5'    agcuguauuacugaggg agaaguuaua cgcu    gua uguauu 
      ||||||||||||||||| |||||||||| ||||    ||| ||||| a
3'    ucgacauggugauuccc uuuucgauau gcga    uau acgugu 
   cua                 c          -    auac   c       
Get sequence
Deep sequencing
46 reads, 1.3e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_30: 133868-133961 [-]
intergenic
Database links

Mature sequence pxy-miR-965

Accession MIMAT0033719
Sequence

18 - 

gggagaaguuauaucgcuguaug

 - 40

Get sequence
Deep sequencing19 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1