Stem-loop sequence pxy-mir-8505

AccessionMI0027312 (change log)
DescriptionPlutella xylostella miR-8505 stem-loop
Stem-loop
   auc  u                       au     uu 
5'    ag cguuaaucuagagucuauggagg  uaggg  g
      || |||||||||||||||||||||||  |||||   
3'    uc gcaauuagaucuuagauaccucc  auccc  g
   uca  c                       gc     ca 
Get sequence
Deep sequencing
36 reads, 950 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_76: 65967-66044 [+]
intergenic
Database links

Mature sequence pxy-miR-8505

Accession MIMAT0033720
Sequence

51 - 

cuccauagauucuagauuaacg

 - 72

Get sequence
Deep sequencing36 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1