![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence pxy-mir-8537-1 |
|||||
Accession | MI0027313 (change log) | ||||
Description | Plutella xylostella miR-8537-1 stem-loop | ||||
Stem-loop |
auc aauug ag uua
5' gucgcuguuauugcaaaauguucuaugucaucgaa auuuug auuuuga u
||||||||||||||||||||||||||||||||||| |||||| |||||||
3' cagcgacaauaacguuuuacaagauacaguagcuu uaaagc ugaaacu a
cau auaua -a uag
|
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence pxy-miR-8537-5p |
|
Accession | MIMAT0033721 |
Sequence |
7 - gcuguuauugcaaaauguucua - 28 |
Deep sequencing | 2 reads, 1 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24236051
"Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)"
PLoS One. 8:e78787(2013).
|