Stem-loop sequence pxy-mir-8537-1

AccessionMI0027313 (change log)
DescriptionPlutella xylostella miR-8537-1 stem-loop
Stem-loop
   auc                                   aauug      ag       uua 
5'    gucgcuguuauugcaaaauguucuaugucaucgaa     auuuug  auuuuga   u
      |||||||||||||||||||||||||||||||||||     ||||||  |||||||    
3'    cagcgacaauaacguuuuacaagauacaguagcuu     uaaagc  ugaaacu   a
   cau                                   auaua      -a       uag 
Get sequence
Deep sequencing
2 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_538: 14465-14587 [-]
intergenic
Database links

Mature sequence pxy-miR-8537-5p

Accession MIMAT0033721
Sequence

7 - 

gcuguuauugcaaaauguucua

 - 28

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1