Stem-loop sequence pxy-mir-8506

AccessionMI0027314 (change log)
DescriptionPlutella xylostella miR-8506 stem-loop
Stem-loop
   aug     --------                    -    c 
5'    ccgcc        ugugacucucacaccuggua cguu g
      |||||        |||||||||||||||||||| ||||  
3'    ggugg        acacugggaguguggauuau guag u
   gga     uuugaucg                    c    g 
Get sequence
Deep sequencing
132 reads, 3.5e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_171: 245347-245423 [+]
intergenic
scaffold_240: 78634-78710 [-]
intergenic
scaffold_534: 79491-79567 [+]
intergenic
Database links

Mature sequence pxy-miR-8506

Accession MIMAT0033722
Sequence

44 - 

uuaggugugagggucacagc

 - 63

Get sequence
Deep sequencing127 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1