Stem-loop sequence pxy-mir-8507

AccessionMI0027316 (change log)
DescriptionPlutella xylostella miR-8507 stem-loop
Stem-loop
   aug   au     cc        -             c  a a    uuu 
5'    gca  ggccg  uugucagg ggguuuuuggaua gc g augu   g
      |||  |||||  |||||||| ||||||||||||| || | ||||    
3'    cgu  ccggu  aauagucu cucaaaaaccuau cg c uaca   u
   cug   cu     uu        a             a  a c    uac 
Get sequence
Deep sequencing
169 reads, 4.75e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_409: 29033-29133 [+]
intergenic
Database links

Mature sequence pxy-miR-8507-5p

Accession MIMAT0033724
Sequence

22 - 

ggggguuuuuggauacgcagaa

 - 43

Get sequence
Deep sequencing44 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8507-3p

Accession MIMAT0033725
Sequence

60 - 

cagcauauccaaaaacucaucug

 - 82

Get sequence
Deep sequencing125 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1