Stem-loop sequence pxy-mir-184

AccessionMI0027318 (change log)
DescriptionPlutella xylostella miR-184 stem-loop
Literature search

2 open access papers mention pxy-mir-184
(3 sentences)

Stem-loop
   ------------------------------------------auugaauuucauuaguucucucc     -  g  aga   au     ugac 
5'                                                                  gcgcg ga cu   cgg  guugc    c
                                                                    ||||| || ||   |||  |||||     
3'                                                                  cgcgc cu gg   gcu  uagcg    u
   gugcuugaauagucaagaggcagauauauuucuuguuuuuguaggcuguuuguuaaauuugacga     a  a  -ca   -c     uuca 
Get sequence
Deep sequencing
195 reads, 5.8e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_178: 522909-523051 [+]
intergenic
Database links

Mature sequence pxy-miR-184

Accession MIMAT0033727
Sequence

119 - 

uagacggagaacugauaag

 - 137

Get sequence
Deep sequencing195 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1