Stem-loop sequence pxy-mir-8508

AccessionMI0027319 (change log)
DescriptionPlutella xylostella miR-8508 stem-loop
Stem-loop
   ----------------------------------------auugauauuuguuuauua       cc    a             a aau 
5'                                                           aaugaga  uggc uaaagauaaaaau c   u
                                                             |||||||  |||| ||||||||||||| |    
3'                                                           uuauuuu  aucg auuucuauuuuua g   u
   acuaucaaacuauuacccugugucauugucacuuucaauacuaucgcuauguuuuaaa       --    a             a aaa 
Get sequence
Deep sequencing
377 reads, 9.8e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_133: 529907-530046 [+]
intergenic
Database links

Mature sequence pxy-miR-8508

Accession MIMAT0033728
Sequence

20 - 

augagaccuggcauaaagauaaaa

 - 43

Get sequence
Deep sequencing361 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1