Stem-loop sequence pxy-mir-2733a

AccessionMI0027320 (change log)
DescriptionPlutella xylostella miR-2733a stem-loop
Gene family MIPF0000766; mir-2733
Stem-loop
   auu    ug   g    c       uc     aa    cgcu 
5'    ucuu  agc gcag aaucgca  cucag  ggca    u
      ||||  ||| |||| |||||||  |||||  ||||    u
3'    agaa  ucg cguc uuagugu  ggguc  cugu    a
   uac    gu   g    c       uu     -a    cuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_83: 426291-426376 [-]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-2733a
pxy-mir-2733ascaffold_83: 426291-426376 [-]
pxy-mir-8488scaffold_83: 422117-422222 [-]
Database links

Mature sequence pxy-miR-2733a

Accession MIMAT0033729
Sequence

52 - 

ucacuggguuugugauuccugc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1