Stem-loop sequence pxy-mir-7b

AccessionMI0027321 (change log)
DescriptionPlutella xylostella miR-7b stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   caa      ucgauu   -   ag     u   a  c          g     uuau 
5'    gaggcg      gcc ccg  uugua gga ga uagugauuuu uuguu    u
      ||||||      ||| |||  ||||| ||| || |||||||||| |||||     
3'    cuucgu      cgg ggc  aacau ccu cu aucacuaagg aacaa    g
   agg      ---ucc   u   ga     c   -  a          -     uuaa 
Get sequence
Deep sequencing
66 reads, 1.68e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_178: 161602-161711 [+]
intergenic
Database links

Mature sequence pxy-miR-7b

Accession MIMAT0033730
Sequence

65 - 

caaggaaucacuaaucucccua

 - 86

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1