Stem-loop sequence pxy-mir-8509

AccessionMI0027322 (change log)
DescriptionPlutella xylostella miR-8509 stem-loop
Stem-loop
   caa  -  aaacu                a          g      au g 
5'    gc ca     cccggaucgguuuaua auccucuuuu cacuga  g g
      || ||     |||||||||||||||| |||||||||| ||||||  |  
3'    cg gu     gggccuagcuagaugu uaggagaaaa gugacu  u c
   caa  c  ---au                c          g      cg a 
Get sequence
Deep sequencing
60 reads, 1.78e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_89: 839301-839400 [-]
intergenic
Database links

Mature sequence pxy-miR-8509

Accession MIMAT0033731
Sequence

25 - 

uauaaauccucuuuugcacuga

 - 46

Get sequence
Deep sequencing27 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1