Stem-loop sequence pxy-mir-8510b

AccessionMI0027325 (change log)
DescriptionPlutella xylostella miR-8510b stem-loop
Gene family MIPF0001886; mir-8510
Stem-loop
   caa   g    --      -  --g     a    g        c  a   -  g 
5'    gcg uggu  cuguuc uc   ucgau cugu aucucacc gc agu cg u
      ||| ||||  |||||| ||   ||||| |||| |||||||| || ||| ||  
3'    cgc acca  ggcgag ag   agcua gaua uagagugg cg uca gu c
   uca   -    ac      g  gga     c    g        a  c   c  g 
Get sequence
Deep sequencing
314 reads, 8.2e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_858: 943-1047 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8510b
pxy-mir-8510a-6scaffold_858: 134-210 [+]
pxy-mir-8510a-3scaffold_858: 521-587 [+]
pxy-mir-8510bscaffold_858: 943-1047 [+]
Database links

Mature sequence pxy-miR-8510b-5p

Accession MIMAT0033734
Sequence

26 - 

acugugaucucacccgcaagu

 - 46

Get sequence
Deep sequencing59 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8510b-3p

Accession MIMAT0033735
Sequence

58 - 

ucgcaggugagaugauagcau

 - 78

Get sequence
Deep sequencing240 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1