Stem-loop sequence pxy-mir-750

AccessionMI0027326 (change log)
DescriptionPlutella xylostella miR-750 stem-loop
Gene family MIPF0000796; mir-750
Literature search

2 open access papers mention pxy-mir-750
(2 sentences)

Stem-loop
   caa          c         c  -g      a a   uucgca 
5'    ggcuccacgu ugaguugga ag  ggaucu g cag      a
      |||||||||| ||||||||| ||  |||||| | |||       
3'    ccgaggugcg acucgaccu uc  ucuaga c guc      c
   caa          c         u  aa      c -   uucaua 
Get sequence
Deep sequencing
209 reads, 5.5e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_156: 101445-101536 [+]
intergenic
Database links

Mature sequence pxy-miR-750

Accession MIMAT0033736
Sequence

17 - 

aguuggacaggggaucuagaca

 - 38

Get sequence
Deep sequencing43 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1