![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence pxy-mir-263 |
|||||
Accession | MI0027328 (change log) | ||||
Description | Plutella xylostella miR-263 stem-loop | ||||
Gene family | MIPF0000122; mir-263 | ||||
Literature search |
1 open access papers mention pxy-mir-263 | ||||
Stem-loop |
cac a a ca g ga au uu ug 5' ucgu cugacac gg aug cacug aga ucacggg u u |||| ||||||| || ||| ||||| ||| ||||||| | a 3' agcg ggcugug uc uac gugau ucu ggugccc a a cuu - g uc g uc -- cc uc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence pxy-miR-263 |
|
Accession | MIMAT0033738 |
Sequence |
59 - cguggucucuuaguggcaucuc - 80 |
Deep sequencing | 15 reads, 4 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24236051
"Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)"
PLoS One. 8:e78787(2013).
|