Stem-loop sequence pxy-mir-263

AccessionMI0027328 (change log)
DescriptionPlutella xylostella miR-263 stem-loop
Gene family MIPF0000122; mir-263
Literature search

1 open access papers mention pxy-mir-263
(5 sentences)

Stem-loop
   cac    a       a  ca   g     ga   au       uu ug 
5'    ucgu cugacac gg  aug cacug  aga  ucacggg  u  u
      |||| ||||||| ||  ||| |||||  |||  |||||||  |  a
3'    agcg ggcugug uc  uac gugau  ucu  ggugccc  a  a
   cuu    -       g  uc   g     uc   --       cc uc 
Get sequence
Deep sequencing
530 reads, 1.45e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_154: 418634-418729 [-]
intergenic
Database links

Mature sequence pxy-miR-263

Accession MIMAT0033738
Sequence

59 - 

cguggucucuuaguggcaucuc

 - 80

Get sequence
Deep sequencing15 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1