Stem-loop sequence pxy-mir-8511

AccessionMI0027329 (change log)
DescriptionPlutella xylostella miR-8511 stem-loop
Stem-loop
   cag             c  uuuccguuucgacagcuucugguagauuucauccacagu 
5'    agucagucuuuuc uc                                       u
      ||||||||||||| ||                                       u
3'    ucagucagagaag gg                                       u
   aua             c  acgaagaugagacaguagacgaagggucuuugguccgua 
Get sequence
Deep sequencing
49 reads, 1.52e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_1068: 20577-20695 [-]
intergenic
Database links

Mature sequence pxy-miR-8511

Accession MIMAT0033739
Sequence

6 - 

ucagucuuuuccucuuuc

 - 23

Get sequence
Deep sequencing48 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1