Stem-loop sequence pxy-mir-2733b

AccessionMI0027330 (change log)
DescriptionPlutella xylostella miR-2733b stem-loop
Gene family MIPF0000766; mir-2733
Stem-loop
   cau     a  gu    ca        g     a    guuuu 
5'    ucuaa ag  acag  aucgcaug ucagu gaca     u
      ||||| ||  ||||  |||||||| ||||| ||||      
3'    agauu uc  uguc  uagugugu gguca cugu     g
   cau     g  ug    cg        g     -    aauaa 
Get sequence
Deep sequencing
1 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_612: 111379-111465 [-]
intergenic
Database links

Mature sequence pxy-miR-2733b-5p

Accession MIMAT0033740
Sequence

16 - 

agcaaucgcauggucaguagaca

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-2733b-3p

Accession MIMAT0033741
Sequence

53 - 

ucacugggugugugaugccugu

 - 74

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1