Stem-loop sequence pxy-mir-8515-1

AccessionMI0027331 (change log)
DescriptionPlutella xylostella miR-8515-1 stem-loop
Gene family MIPF0002064; mir-8515
Stem-loop
   -------cca      a  cau  -c    - g   - -                            c    au  c                                 -gc ugc 
5'           gcgagu gc   cg  gccc c acc c ccgccgccgcgccgccaccgcgcgcguu cccu  cu ccugucguugcauucauuccauuaccggccgcg   g   a
             |||||| ||   ||  |||| | ||| | |||||||||||||||||||||||||||| ||||  || |||||||||||||||||||||||||||||||||   |    
3'           ugcuca cg   gc  cggg g ugg g ggcggcggcgcggcgguggcgcgcgcaa ggga  ga ggacagcaacguaaguaagguaauggccggcgu   c   g
   gugacaucua      g  --c  uu    c g   c c                            c    gg  a                                 auu uug 
Get sequence
Deep sequencing
46 reads, 1.18e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_6: 1578444-1578665 [-]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8515-1
pxy-mir-8515-2scaffold_6: 1578455-1578655 [+]
pxy-mir-8515-1scaffold_6: 1578444-1578665 [-]
Database links

Mature sequence pxy-miR-8515

Accession MIMAT0033742
Sequence

117 - 

cggccgguaauggaaugaaugc

 - 138

Get sequence
Deep sequencing44 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1