Stem-loop sequence pxy-mir-8517a

AccessionMI0027332 (change log)
DescriptionPlutella xylostella miR-8517a stem-loop
Gene family MIPF0002077; mir-8517
Literature search

1 open access papers mention pxy-mir-8517a
(1 sentences)

Stem-loop
   cca     u                     u          ga   a       g       c    a       a        a 
5'    uauag cuagcccccuuauucauaaaa aguuagugga  cuu agcuauu aacuguu uguc cucuuug cagagaac a
      ||||| ||||||||||||||||||||| ||||||||||  ||| ||||||| ||||||| |||| ||||||| |||||||| u
3'    auauc gauugggggaauaaguauuuu ucaauuaccu  gaa ucgauaa uugacaa acag gagagac guuucuug u
   uac     u                     u          gc   a       g       a    g       a        u 
Get sequence
Deep sequencing
314 reads, 8e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_244: 75865-76037 [-]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8517a
pxy-mir-8497scaffold_244: 76387-76574 [+]
pxy-mir-8517ascaffold_244: 75865-76037 [-]
Database links

Mature sequence pxy-miR-8517a

Accession MIMAT0033743
Sequence

51 - 

uauugaacuguucugucacucuuug

 - 75

Get sequence
Deep sequencing16 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1