Stem-loop sequence pxy-mir-8513

AccessionMI0027334 (change log)
DescriptionPlutella xylostella miR-8513 stem-loop
Stem-loop
   ccg      ugu                      ucaugu   g      u 
5'    aguugc   aaggaacuuaaaucgaaugucg      acu ucaaag a
      ||||||   ||||||||||||||||||||||      ||| |||||| a
3'    ucaacg   uuucuugaauuuggcuuacagu      ugg aguuuc g
   cga      ucu                      ------   a      g 
Get sequence
Deep sequencing
2 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_12: 812441-812539 [-]
intergenic
Database links

Mature sequence pxy-miR-8513-5p

Accession MIMAT0033744
Sequence

12 - 

uaaggaacuuaaaucgaauguc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8513-3p

Accession MIMAT0033745
Sequence

69 - 

cauucgguuuaaguucuuuucu

 - 90

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1