Stem-loop sequence pxy-mir-8513

Accession

MI0027334 (change log)

Description

Plutella xylostella miR-8513 stem-loop

Stem-loop

   ccg      ugu                      ucaugu   g      u 
5'    aguugc   aaggaacuuaaaucgaaugucg      acu ucaaag a
      ||||||   ||||||||||||||||||||||      ||| |||||| a
3'    ucaacg   uuucuugaauuuggcuuacagu      ugg aguuuc g
   cga      ucu                      ------   a      g 

Deep sequencing

2 reads, 100 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (1.0): scaffold_12: 812441-812539 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0027334

Mature sequence pxy-miR-8513-5p

• Accession: MIMAT0033744
• Sequence: 12 - uaaggaacuuaaaucgaauguc - 33
• Evidence: experimental; Illumina [1]

Mature sequence pxy-miR-8513-3p

• Accession: MIMAT0033745
• Sequence: 69 - cauucgguuuaaguucuuuucu - 90
• Deep sequencing: 1 reads, 1 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:24236051 "Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)" Liang P, Feng B, Zhou X, Gao X PLoS One. 8:e78787(2013).