Stem-loop sequence pxy-mir-8514

AccessionMI0027335 (change log)
DescriptionPlutella xylostella miR-8514 stem-loop
Stem-loop
   cc                    -cca  u 
5'   ggcgagaagccguaucguug    gu g
     ||||||||||||||||||||    || a
3'   ucgcuuuucggcauagcgac    cg g
   gu                    acug  u 
Get sequence
Deep sequencing
60 reads, 1.55e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_451: 115006-115065 [-]
intergenic
Database links

Mature sequence pxy-miR-8514-5p

Accession MIMAT0033746
Sequence

4 - 

gcgagaagccguaucguugcca

 - 25

Get sequence
Deep sequencing38 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8514-3p

Accession MIMAT0033747
Sequence

38 - 

acagcgauacggcuuuucgcuu

 - 59

Get sequence
Deep sequencing22 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1