Stem-loop sequence pxy-mir-8515-2

AccessionMI0027338 (change log)
DescriptionPlutella xylostella miR-8515-2 stem-loop
Gene family MIPF0002064; mir-8515
Stem-loop
   cga       gaag    cc   g g                            g    cc                                   auaagaa 
5'    gucgcgc    cccg  acc c ccgccgccgcgccgccaccgcgcgcguu cccu  cuuccugucguugcauucauuccauuaccggccgc       c
      |||||||    ||||  ||| | |||||||||||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||||||       c
3'    uagcgcg    gggc  ugg g ggcggcggcgcggcgguggcgcgcgcaa ggga  gagggacagcaacguaaguaagguaauggccggcg       u
   cgg       ----    --   - -                            g    ua                                   ccgcacg 
Get sequence
Deep sequencing
59 reads, 1.48e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_6: 1578455-1578655 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8515-2
pxy-mir-8515-1scaffold_6: 1578444-1578665 [-]
pxy-mir-8515-2scaffold_6: 1578455-1578655 [+]
Database links

Mature sequence pxy-miR-8515

Accession MIMAT0033742
Sequence

115 - 

cggccgguaauggaaugaaugc

 - 136

Get sequence
Deep sequencing44 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1