Stem-loop sequence pxy-mir-8521b-10

AccessionMI0027340 (change log)
DescriptionPlutella xylostella miR-8521b-10 stem-loop
Gene family MIPF0001871; mir-8521
Stem-loop
   cgc   -a  -                  - gg 
5'    ggc  gg cagaauucgggacgagcc c  a
      |||  || |||||||||||||||||| |   
3'    ccg  uc guuuuaagcccuguucgg g  g
   aaa   gc  a                  u gc 
Get sequence
Deep sequencing
118 reads, 3e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_127: 934840-934904 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8521b-10
pxy-mir-8521b-4scaffold_127: 925344-925452 [+]
pxy-mir-8521b-9scaffold_127: 927294-927386 [+]
pxy-mir-8521b-8scaffold_127: 929984-930055 [+]
pxy-mir-8521b-2scaffold_127: 930604-930701 [+]
pxy-mir-8521a-5scaffold_127: 933148-933265 [+]
pxy-mir-8521b-10scaffold_127: 934840-934904 [+]
pxy-mir-8521b-1scaffold_127: 936871-936942 [+]
pxy-mir-8543scaffold_127: 938549-938622 [+]
pxy-mir-8493scaffold_127: 944000-944075 [+]
Database links

Mature sequence pxy-miR-8521b

Accession MIMAT0033751
Sequence

39 - 

cuugucccgaauuuugacucggcc

 - 62

Get sequence
Deep sequencing1275 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1