Stem-loop sequence pxy-mir-8521b-10

Accession

MI0027340 (change log)

Description

Plutella xylostella miR-8521b-10 stem-loop

Gene family

MIPF0001871; mir-8521

Stem-loop

   cgc   -a  -                  - gg 
5'    ggc  gg cagaauucgggacgagcc c  a
      |||  || |||||||||||||||||| |   
3'    ccg  uc guuuuaagcccuguucgg g  g
   aaa   gc  a                  u gc 

Deep sequencing

118 reads, 3e+03 reads per million, 4 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (1.0): scaffold_127: 934840-934904 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from pxy-mir-8521b-10

• pxy-mir-8521b-4: scaffold_127: 925344-925452 [+]
• pxy-mir-8521b-9: scaffold_127: 927294-927386 [+]
• pxy-mir-8521b-8: scaffold_127: 929984-930055 [+]
• pxy-mir-8521b-2: scaffold_127: 930604-930701 [+]
• pxy-mir-8521a-5: scaffold_127: 933148-933265 [+]
• pxy-mir-8521b-10: scaffold_127: 934840-934904 [+]
• pxy-mir-8521b-1: scaffold_127: 936871-936942 [+]
• pxy-mir-8543: scaffold_127: 938549-938622 [+]
• pxy-mir-8493: scaffold_127: 944000-944075 [+]

Database links

• miRBase Tracker:MI0027340

Mature sequence pxy-miR-8521b

• Accession: MIMAT0033751
• Sequence: 39 - cuugucccgaauuuugacucggcc - 62
• Deep sequencing: 1275 reads, 4 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:24236051 "Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)" Liang P, Feng B, Zhou X, Gao X PLoS One. 8:e78787(2013).