Stem-loop sequence pxy-mir-8521a-3

AccessionMI0027341 (change log)
DescriptionPlutella xylostella miR-8521a-3 stem-loop
Gene family MIPF0001871; mir-8521
Stem-loop
   ---c    c                    --     
5'     gcgg agucagaauucgggacaagc  ccgg 
       |||| ||||||||||||||||||||  ||| g
3'     cguc ucaguuuuaagcccuguucg  ggcg 
   aaac    -                    cu     
Get sequence
Deep sequencing
104 reads, 2.65e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_127: 917960-918024 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8521a-3
pxy-mir-8521b-5scaffold_127: 916974-917079 [+]
pxy-mir-8521a-3scaffold_127: 917960-918024 [+]
pxy-mir-8521b-6scaffold_127: 919385-919480 [+]
pxy-mir-8521b-3scaffold_127: 920219-920290 [+]
pxy-mir-8521b-11scaffold_127: 921914-922002 [+]
pxy-mir-8521b-7scaffold_127: 923694-923785 [+]
pxy-mir-8521b-4scaffold_127: 925344-925452 [+]
pxy-mir-8521b-9scaffold_127: 927294-927386 [+]
Database links

Mature sequence pxy-miR-8521a

Accession MIMAT0033752
Sequence

39 - 

cuugucccgaauuuugacucugcc

 - 62

Get sequence
Deep sequencing502 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1