Stem-loop sequence pxy-mir-8516

AccessionMI0027342 (change log)
DescriptionPlutella xylostella miR-8516 stem-loop
Stem-loop
   cgc  c  g        acagguguaauaugcccgaccacuuauauacauaucuaaauu 
5'    gg gc gcgagcga                                          g
      || || ||||||||                                          a
3'    cc cg cgcucgcu                                          a
   uca  -  g        gcggugacuucguucccuaaguacauaucguaaauacagagu 
Get sequence
Deep sequencing
6 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_151: 893804-893923 [-]
intergenic
Database links

Mature sequence pxy-miR-8516

Accession MIMAT0033753
Sequence

7 - 

gcggcgagcgaacaggu

 - 23

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1