Stem-loop sequence pxy-mir-8521a-1

Accession

MI0027343 (change log)

Description

Plutella xylostella miR-8521a-1 stem-loop

Gene family

MIPF0001871; mir-8521

Stem-loop

   c u     ucuc    gc  c                    --     
5'  g uuuug    uggc  gg agucagaauucgggacaagc  ccgg 
    | |||||    ||||  || ||||||||||||||||||||  ||| a
3'  c aaaac    accg  uc ucaguuuuaagcccuguucg  ggcg 
   a c     -uaa    --  -                    cu     

Deep sequencing

106 reads, 2.7e+03 reads per million, 4 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (1.0): scaffold_38: 404173-404261 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from pxy-mir-8521a-1

• pxy-mir-8521b-3: scaffold_38: 403231-403302 [+]
• pxy-mir-8521a-1: scaffold_38: 404173-404261 [+]
• pxy-mir-8521a-4: scaffold_38: 409399-409482 [+]
• pxy-mir-8521b-3: scaffold_38: 439528-439599 [+]

Database links

• miRBase Tracker:MI0027343

Mature sequence pxy-miR-8521a

• Accession: MIMAT0033752
• Sequence: 54 - cuugucccgaauuuugacucugcc - 77
• Deep sequencing: 502 reads, 4 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:24236051 "Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)" Liang P, Feng B, Zhou X, Gao X PLoS One. 8:e78787(2013).