Stem-loop sequence pxy-mir-8521a-2

AccessionMI0027344 (change log)
DescriptionPlutella xylostella miR-8521a-2 stem-loop
Gene family MIPF0001871; mir-8521
Stem-loop
   c u     ucuc    gc  c                    --     
5'  g uuuug    uggc  gg agucagaauucgggacaagc  ccgg 
    | |||||    ||||  || ||||||||||||||||||||  ||| a
3'  c aaaac    accg  uc ucaguuuuaagcccuguucg  ggcg 
   a c     -uaa    --  -                    cu     
Get sequence
Deep sequencing
106 reads, 2.7e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_38: 415393-415481 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8521a-2
pxy-mir-8521a-4scaffold_38: 409399-409482 [+]
pxy-mir-8521a-2scaffold_38: 415393-415481 [+]
Database links

Mature sequence pxy-miR-8521a

Accession MIMAT0033752
Sequence

54 - 

cuugucccgaauuuugacucugcc

 - 77

Get sequence
Deep sequencing502 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1