Stem-loop sequence pxy-mir-8521b-11

AccessionMI0027345 (change log)
DescriptionPlutella xylostella miR-8521b-11 stem-loop
Gene family MIPF0001871; mir-8521
Stem-loop 
   c u     ucuc    g  uc                    --  g 
5'  g uuuug    uggc cg  agucagaauucgggacaagc  cc g
    | |||||    |||| ||  ||||||||||||||||||||  || a
3'  c aaaac    accg gc  ucaguuuuaagcccuguucg  gg g
   a c     -uaa    -  --                    cu  u
Get sequence
Deep sequencing
122 reads, 3.1e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_127: 921914-922002 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8521b-11
pxy-mir-8521b-5scaffold_127: 916974-917079 [+]
pxy-mir-8521a-3scaffold_127: 917960-918024 [+]
pxy-mir-8521b-6scaffold_127: 919385-919480 [+]
pxy-mir-8521b-3scaffold_127: 920219-920290 [+]
pxy-mir-8521b-11scaffold_127: 921914-922002 [+]
pxy-mir-8521b-7scaffold_127: 923694-923785 [+]
pxy-mir-8521b-4scaffold_127: 925344-925452 [+]
pxy-mir-8521b-9scaffold_127: 927294-927386 [+]
pxy-mir-8521b-8scaffold_127: 929984-930055 [+]
pxy-mir-8521b-2scaffold_127: 930604-930701 [+]
Database links

Mature sequence pxy-miR-8521b

Accession MIMAT0033751
Sequence

54 -  

cuugucccgaauuuugacucggcc

 - 77

Get sequence
Deep sequencing1275 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24236051 "Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)" Liang P, Feng B, Zhou X, Gao X PLoS One. 8:e78787(2013).