Stem-loop sequence pxy-mir-8517b

AccessionMI0027346 (change log)
DescriptionPlutella xylostella miR-8517b stem-loop
Gene family MIPF0002077; mir-8517
Literature search

1 open access papers mention pxy-mir-8517b
(1 sentences)

Stem-loop
   cua                           a        a             c     aacaa      c 
5'    acccccuuauucauaaaaaaguuacug acggauua cuauugaacuguu uguca     uuuguu u
      ||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||     ||||||  
3'    ugggggaauaaguauuuuuucaaugac ugccuaau gauaacuugacaa acagu     agacag u
   gaa                           c        c             a     --gag      u 
Get sequence
Deep sequencing
409 reads, 1.06e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_143: 400674-400815 [+]
intergenic
Database links

Mature sequence pxy-miR-8517b

Accession MIMAT0033754
Sequence

38 - 

uaacuauugaacuguucugucaaa

 - 61

Get sequence
Deep sequencing13 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1