Stem-loop sequence pxy-mir-8518

AccessionMI0027348 (change log)
DescriptionPlutella xylostella miR-8518 stem-loop
Stem-loop
   -    c    c     u           a     g 
5'  cucc ggac cucgc gauacuggugg agcgc a
    |||| |||| ||||| ||||||||||| ||||| g
3'  gagg ccug gagcg cuaugaccacc uugcg g
   g    -    c     c           g     g 
Get sequence
Deep sequencing
109 reads, 3.08e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_86: 545150-545220 [+]
intergenic
Database links

Mature sequence pxy-miR-8518

Accession MIMAT0033756
Sequence

12 - 

ucgcugauacugguggaagcgc

 - 33

Get sequence
Deep sequencing108 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1