![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence pxy-mir-8518 |
|||||
Accession | MI0027348 (change log) | ||||
Description | Plutella xylostella miR-8518 stem-loop | ||||
Stem-loop |
- c c u a g 5' cucc ggac cucgc gauacuggugg agcgc a |||| |||| ||||| ||||||||||| ||||| g 3' gagg ccug gagcg cuaugaccacc uugcg g g - c c g g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence pxy-miR-8518 |
|
Accession | MIMAT0033756 |
Sequence |
12 - ucgcugauacugguggaagcgc - 33 |
Deep sequencing | 108 reads, 4 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24236051
"Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)"
PLoS One. 8:e78787(2013).
|