Stem-loop sequence pxy-mir-8521b-8

Accession

MI0027349 (change log)

Description

Plutella xylostella miR-8521b-8 stem-loop

Gene family

MIPF0001871; mir-8521

Stem-loop

   cuc    g  gc                    --     
5'    uggc cg  agucagaauucgggacaagc  ccgg 
      |||| ||  ||||||||||||||||||||  ||| a
3'    accg gc  ucaguuuuaagcccuguucg  ggcg 
   aaa    -  --                    uu     

Deep sequencing

121 reads, 3.08e+03 reads per million, 4 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (1.0): scaffold_127: 929984-930055 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from pxy-mir-8521b-8

• pxy-mir-8521b-3: scaffold_127: 920219-920290 [+]
• pxy-mir-8521b-11: scaffold_127: 921914-922002 [+]
• pxy-mir-8521b-7: scaffold_127: 923694-923785 [+]
• pxy-mir-8521b-4: scaffold_127: 925344-925452 [+]
• pxy-mir-8521b-9: scaffold_127: 927294-927386 [+]
• pxy-mir-8521b-8: scaffold_127: 929984-930055 [+]
• pxy-mir-8521b-2: scaffold_127: 930604-930701 [+]
• pxy-mir-8521a-5: scaffold_127: 933148-933265 [+]
• pxy-mir-8521b-10: scaffold_127: 934840-934904 [+]
• pxy-mir-8521b-1: scaffold_127: 936871-936942 [+]
• pxy-mir-8543: scaffold_127: 938549-938622 [+]

Database links

• miRBase Tracker:MI0027349

Mature sequence pxy-miR-8521b

• Accession: MIMAT0033751
• Sequence: 45 - cuugucccgaauuuugacucggcc - 68
• Deep sequencing: 1275 reads, 4 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:24236051 "Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)" Liang P, Feng B, Zhou X, Gao X PLoS One. 8:e78787(2013).