Stem-loop sequence pxy-mir-8521b-8

AccessionMI0027349 (change log)
DescriptionPlutella xylostella miR-8521b-8 stem-loop
Gene family MIPF0001871; mir-8521
Stem-loop
   cuc    g  gc                    --     
5'    uggc cg  agucagaauucgggacaagc  ccgg 
      |||| ||  ||||||||||||||||||||  ||| a
3'    accg gc  ucaguuuuaagcccuguucg  ggcg 
   aaa    -  --                    uu     
Get sequence
Deep sequencing
121 reads, 3.08e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_127: 929984-930055 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8521b-8
pxy-mir-8521b-3scaffold_127: 920219-920290 [+]
pxy-mir-8521b-11scaffold_127: 921914-922002 [+]
pxy-mir-8521b-7scaffold_127: 923694-923785 [+]
pxy-mir-8521b-4scaffold_127: 925344-925452 [+]
pxy-mir-8521b-9scaffold_127: 927294-927386 [+]
pxy-mir-8521b-8scaffold_127: 929984-930055 [+]
pxy-mir-8521b-2scaffold_127: 930604-930701 [+]
pxy-mir-8521a-5scaffold_127: 933148-933265 [+]
pxy-mir-8521b-10scaffold_127: 934840-934904 [+]
pxy-mir-8521b-1scaffold_127: 936871-936942 [+]
pxy-mir-8543scaffold_127: 938549-938622 [+]
Database links

Mature sequence pxy-miR-8521b

Accession MIMAT0033751
Sequence

45 - 

cuugucccgaauuuugacucggcc

 - 68

Get sequence
Deep sequencing1275 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1