![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence pxy-mir-8521b-3 |
||||||||||||||||||||
Accession | MI0027350 (change log) | |||||||||||||||||||
Description | Plutella xylostella miR-8521b-3 stem-loop | |||||||||||||||||||
Gene family | MIPF0001871; mir-8521 | |||||||||||||||||||
Stem-loop |
cuc g gc - gg 5' uggc cg agucagaauucgggacgagcc c a |||| || ||||||||||||||||||||| | 3' accg gc ucaguuuuaagcccuguucgg g g uaa - -- u gc |
|||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||
Genome context |
|
|||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||
Database links |
|
Mature sequence pxy-miR-8521b |
|
Accession | MIMAT0033751 |
Sequence |
45 - cuugucccgaauuuugacucggcc - 68 |
Deep sequencing | 1275 reads, 4 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24236051
"Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)"
PLoS One. 8:e78787(2013).
|