Stem-loop sequence pxy-mir-8521b-3

Accession

MI0027350 (change log)

Description

Plutella xylostella miR-8521b-3 stem-loop

Gene family

MIPF0001871; mir-8521

Stem-loop

   cuc    g  gc                     - gg 
5'    uggc cg  agucagaauucgggacgagcc c  a
      |||| ||  ||||||||||||||||||||| |   
3'    accg gc  ucaguuuuaagcccuguucgg g  g
   uaa    -  --                     u gc 

Deep sequencing

120 reads, 3.05e+03 reads per million, 4 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

Coordinates (1.0)	Overlapping transcripts
scaffold_127: 920219-920290 [+]	intergenic
scaffold_38: 403231-403302 [+]	intergenic
scaffold_38: 439528-439599 [+]	intergenic

Clustered miRNAs

< 10kb from pxy-mir-8521b-3

• pxy-mir-8521b-5: scaffold_127: 916974-917079 [+]
• pxy-mir-8521a-3: scaffold_127: 917960-918024 [+]
• pxy-mir-8521b-6: scaffold_127: 919385-919480 [+]
• pxy-mir-8521b-3: scaffold_127: 920219-920290 [+]
• pxy-mir-8521b-11: scaffold_127: 921914-922002 [+]
• pxy-mir-8521b-7: scaffold_127: 923694-923785 [+]
• pxy-mir-8521b-4: scaffold_127: 925344-925452 [+]
• pxy-mir-8521b-9: scaffold_127: 927294-927386 [+]
• pxy-mir-8521b-8: scaffold_127: 929984-930055 [+]

Database links

• miRBase Tracker:MI0027350

Mature sequence pxy-miR-8521b

• Accession: MIMAT0033751
• Sequence: 45 - cuugucccgaauuuugacucggcc - 68
• Deep sequencing: 1275 reads, 4 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:24236051 "Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)" Liang P, Feng B, Zhou X, Gao X PLoS One. 8:e78787(2013).