Stem-loop sequence pxy-mir-8519

Accession

MI0027352 (change log)

Description

Plutella xylostella miR-8519 stem-loop

Literature search

1 open access papers mention pxy-mir-8519
(25 sentences)

Stem-loop

   cug gu       -u           ug   -       --cuaau  uaca      
5'    u  cuaaaaa  uaaaaauguaa  auu ucagaaa       gc    guaca 
      |  |||||||  |||||||||||  ||| |||||||       ||    |||| a
3'    g  gguuuuu  guuuuuauauu  uaa agucuuu       cg    cgugu 
   uug ug       uu           gu   c       acaaagu  --uc      

Deep sequencing

27 reads, 775 reads per million, 4 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (1.0): scaffold_574: 179907-180015 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0027352

Mature sequence pxy-miR-8519

• Accession: MIMAT0033757
• Sequence: 17 - aaaauguaaugauuucagaa - 36
• Deep sequencing: 26 reads, 4 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:24236051 "Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)" Liang P, Feng B, Zhou X, Gao X PLoS One. 8:e78787(2013).