Stem-loop sequence pxy-mir-8519

AccessionMI0027352 (change log)
DescriptionPlutella xylostella miR-8519 stem-loop
Literature search

1 open access papers mention pxy-mir-8519
(25 sentences)

Stem-loop
   cug gu       -u           ug   -       --cuaau  uaca      
5'    u  cuaaaaa  uaaaaauguaa  auu ucagaaa       gc    guaca 
      |  |||||||  |||||||||||  ||| |||||||       ||    |||| a
3'    g  gguuuuu  guuuuuauauu  uaa agucuuu       cg    cgugu 
   uug ug       uu           gu   c       acaaagu  --uc      
Get sequence
Deep sequencing
27 reads, 775 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_574: 179907-180015 [-]
intergenic
Database links

Mature sequence pxy-miR-8519

Accession MIMAT0033757
Sequence

17 - 

aaaauguaaugauuucagaa

 - 36

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1