Stem-loop sequence pxy-mir-8520

AccessionMI0027353 (change log)
DescriptionPlutella xylostella miR-8520 stem-loop
Stem-loop
   cuu      u           a              u    cag  a 
5'    agcccc ucucccacuau cgacucucuggcga gcca   cg c
      |||||| ||||||||||| |||||||||||||| ||||   ||  
3'    uugggg agagggugaua gcugagagaccgcu cggu   gc u
   aau      u           c              u    -ca  a 
Get sequence
Deep sequencing
80 reads, 2.1e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_98: 782739-782833 [-]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8520
pxy-mir-8504scaffold_98: 791835-791984 [-]
pxy-mir-8520scaffold_98: 782739-782833 [-]
pxy-mir-8530scaffold_98: 774474-774560 [-]
Database links

Mature sequence pxy-miR-8520-5p

Accession MIMAT0033758
Sequence

19 - 

uauacgacucucuggcgaugcc

 - 40

Get sequence
Deep sequencing19 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8520-3p

Accession MIMAT0033759
Sequence

58 - 

cuucgccagagagucgcauagu

 - 79

Get sequence
Deep sequencing59 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1