Stem-loop sequence pxy-mir-6497

AccessionMI0027355 (change log)
DescriptionPlutella xylostella miR-6497 stem-loop
Gene family MIPF0001965; mir-6497
Literature search

1 open access papers mention pxy-mir-6497
(1 sentences)

Stem-loop
   cuucggaauaaggauuggcucugagg     g   u   ---g    u      gaa     u   g    u  -      ug ucga       u 
5'                           accgg gcg guc    gguu ggaggg   gcgga gcg ccgg gc cgggcc  g    ugcccgu c
                             ||||| ||| |||    |||| ||||||   ||||| ||| |||| || ||||||  |    |||||||  
3'                           uggcu ugc cgg    ccga ccuccu   cgccu ugc ggcc cg gcccgg  c    gcgggcg a
   --------------cgugcucugcuu     g   -   aaug    u      agg     -   -    u  c      gu ucag       c 
Get sequence
Deep sequencing
17835 reads, 4.83e+05 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_625: 83913-84085 [-]
intergenic
Database links

Mature sequence pxy-miR-6497

Accession MIMAT0033761
Sequence

40 - 

ggguuuggaggggaagcggau

 - 60

Get sequence
Deep sequencing4342 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1