Stem-loop sequence pxy-mir-8522

AccessionMI0027358 (change log)
DescriptionPlutella xylostella miR-8522 stem-loop
Stem-loop
   gaa       acc  c                    u  ua 
5'    aauacag   gu ucggaaccuucggcaaauga gg  a
      |||||||   || |||||||||||||||||||| ||   
3'    uuauguc   ca agucuuggaagccguuuacu cu  a
   cac       aac  u                    -  gc 
Get sequence
Deep sequencing
28 reads, 700 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_220: 518604-518686 [+]
intergenic
Database links

Mature sequence pxy-miR-8522

Accession MIMAT0033763
Sequence

50 - 

auuugccgaagguucugauacc

 - 71

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1