![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence pxy-mir-8522 |
|||||
Accession | MI0027358 (change log) | ||||
Description | Plutella xylostella miR-8522 stem-loop | ||||
Stem-loop |
gaa acc c u ua 5' aauacag gu ucggaaccuucggcaaauga gg a ||||||| || |||||||||||||||||||| || 3' uuauguc ca agucuuggaagccguuuacu cu a cac aac u - gc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence pxy-miR-8522 |
|
Accession | MIMAT0033763 |
Sequence |
50 - auuugccgaagguucugauacc - 71 |
Deep sequencing | 9 reads, 4 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24236051
"Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)"
PLoS One. 8:e78787(2013).
|