Stem-loop sequence pxy-mir-8524-1

AccessionMI0027360 (change log)
DescriptionPlutella xylostella miR-8524-1 stem-loop
Gene family MIPF0002114; mir-8524
Stem-loop
   gac     ac  g        c        auu 
5'    caagu  gg uuugcaag cacauaua   a
      |||||  || |||||||| ||||||||   c
3'    guucg  cc aaacguuc guguaugu   a
   uau     aa  g        a        aug 
Get sequence
Deep sequencing
22 reads, 550 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_247: 236318-236386 [+]
intergenic
Database links

Mature sequence pxy-miR-8524-5p

Accession MIMAT0033765
Sequence

9 - 

acggguuugcaagccacauaua

 - 30

Get sequence
Deep sequencing32 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8524-3p

Accession MIMAT0033766
Sequence

42 - 

uaugugacuugcaaagccaagc

 - 63

Get sequence
Deep sequencing12 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1