Stem-loop sequence pxy-mir-8525

AccessionMI0027362 (change log)
DescriptionPlutella xylostella miR-8525 stem-loop
Stem-loop
   ga u              c           c    ua    uaag 
5'   c auguggugccgugu cuguaugugaa aaca  acug    u
     | |||||||||||||| ||||||||||| ||||  ||||     
3'   g uauaccgcggcaua gauauacacuu uugu  ugac    a
   -a u              a           u    --    caac 
Get sequence
Deep sequencing
17 reads, 475 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_151: 232098-232186 [-]
intergenic
Database links

Mature sequence pxy-miR-8525

Accession MIMAT0033767
Sequence

18 - 

uccuguaugugaacaacauaacug

 - 41

Get sequence
Deep sequencing11 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1