Stem-loop sequence pxy-mir-8526

AccessionMI0027363 (change log)
DescriptionPlutella xylostella miR-8526 stem-loop
Stem-loop
   gcacauuauuucugguaucugcuacuuuuaggagcugaagguuggaaacu  uua     u          ua   c    -    c       uauca 
5'                                                   gu   uguac gucugaggca  caa ccug ucua ucucagg     u
                                                     ||   ||||| ||||||||||  ||| |||| |||| |||||||      
3'                                                   cg   acaug caggcuccgu  guu ggac gggu agagucc     u
   --caaguaacaaaagccucugucuggugcccuucccacggcguccauaua  -ua     u          ug   u    u    -       cacug 
Get sequence
Deep sequencing
14 reads, 350 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_98: 797006-797200 [-]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8526
pxy-mir-8526scaffold_98: 797006-797200 [-]
pxy-mir-8504scaffold_98: 791835-791984 [-]
Database links

Mature sequence pxy-miR-8526

Accession MIMAT0033768
Sequence

72 - 

uacaacccugucuacucucagg

 - 93

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1