Stem-loop sequence pxy-mir-8510a-7

AccessionMI0027364 (change log)
DescriptionPlutella xylostella miR-8510a-7 stem-loop
Gene family MIPF0001886; mir-8510
Stem-loop
     au    ag     a    g        c  a   -  g 
5' gc  cucu  ucgau cugu aucucacc gc agu cg u
   ||  ||||  ||||| |||| |||||||| || ||| ||  
3' cg  gagg  aguua gaua uagagugg cg uca gu c
     ag    ga     c    g        a  c   c  g 
Get sequence
Deep sequencing
308 reads, 8.05e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_211: 756073-756153 [-]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8510a-7
pxy-mir-8510a-6scaffold_211: 758499-758575 [-]
pxy-mir-8510a-5scaffold_211: 758017-758121 [-]
pxy-mir-8510a-1scaffold_211: 757646-757712 [-]
pxy-mir-8510a-4scaffold_211: 757068-757172 [-]
pxy-mir-8510a-7scaffold_211: 756073-756153 [-]
pxy-mir-8510a-8scaffold_211: 755257-755323 [-]
pxy-mir-8510a-2scaffold_211: 754738-754803 [-]
pxy-mir-8510a-2scaffold_211: 754182-754247 [-]
Database links

Mature sequence pxy-miR-8510a-5p

Accession MIMAT0033732
Sequence

16 - 

acugugaucucacccgcaagu

 - 36

Get sequence
Deep sequencing472 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8510a-3p

Accession MIMAT0033733
Sequence

48 - 

ucgcaggugagaugauagcauu

 - 69

Get sequence
Deep sequencing1715 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1