Stem-loop sequence pxy-mir-8527

AccessionMI0027365 (change log)
DescriptionPlutella xylostella miR-8527 stem-loop
Stem-loop
   gcg     --cgcg  -ac    a              c   c 
5'    gagga      gc   uacg gcuuucucguagca ggg c
      |||||      ||   |||| |||||||||||||| |||  
3'    cuccu      ug   augc cgaaagaguaucgu ccu a
   aga     aaauaa  aca    a              -   g 
Get sequence
Deep sequencing
27 reads, 725 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_30: 370946-371029 [-]
intergenic
Database links

Mature sequence pxy-miR-8527

Accession MIMAT0033769
Sequence

49 - 

cuaugagaaagcacguaaca

 - 68

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1