Stem-loop sequence pxy-mir-8529

AccessionMI0027367 (change log)
DescriptionPlutella xylostella miR-8529 stem-loop
Stem-loop
   gc     u      c      u         c    cagucaa 
5'   ugccc uagggu agucuc guauucucc uuca       u
     ||||| |||||| |||||| ||||||||| ||||        
3'   acggg auccua ucggag uauaggagg aagu       a
   gc     c      u      u         -    ccauacu 
Get sequence
Deep sequencing
26 reads, 675 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_14: 1269672-1269758 [-]
intergenic
Database links

Mature sequence pxy-miR-8529

Accession MIMAT0033771
Sequence

14 - 

ucagucucuguauucucccuuca

 - 36

Get sequence
Deep sequencing8 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1