Stem-loop sequence pxy-mir-8489b

AccessionMI0027370 (change log)
DescriptionPlutella xylostella miR-8489b stem-loop
Gene family MIPF0002034; mir-8489
Stem-loop
   gua   u   g     u              a    g   aauu 
5'    gcc aau uagug gccguuaccucuga uuug aug    u
      ||| ||| ||||| |||||||||||||| |||| |||     
3'    cgg uua aucac cggcaauggagacu gaac uac    a
   uac   -   a     -              c    a   aggu 
Get sequence
Deep sequencing
9 reads, 300 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_70: 783518-783605 [-]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8489b
pxy-mir-8489bscaffold_70: 783518-783605 [-]
pxy-mir-8489ascaffold_70: 783516-783607 [+]
Database links

Mature sequence pxy-miR-8489b

Accession MIMAT0033775
Sequence

15 - 

ugugccguuaccucugaauuugg

 - 37

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1