Stem-loop sequence pxy-mir-8489b

Accession

MI0027370 (change log)

Description

Plutella xylostella miR-8489b stem-loop

Gene family

MIPF0002034; mir-8489

Stem-loop

   gua   u   g     u              a    g   aauu 
5'    gcc aau uagug gccguuaccucuga uuug aug    u
      ||| ||| ||||| |||||||||||||| |||| |||     
3'    cgg uua aucac cggcaauggagacu gaac uac    a
   uac   -   a     -              c    a   aggu 

Deep sequencing

9 reads, 300 reads per million, 3 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (1.0): scaffold_70: 783518-783605 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from pxy-mir-8489b

• pxy-mir-8489b: scaffold_70: 783518-783605 [-]
• pxy-mir-8489a: scaffold_70: 783516-783607 [+]

Database links

• miRBase Tracker:MI0027370

Mature sequence pxy-miR-8489b

• Accession: MIMAT0033775
• Sequence: 15 - ugugccguuaccucugaauuugg - 37
• Deep sequencing: 3 reads, 2 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:24236051 "Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)" Liang P, Feng B, Zhou X, Gao X PLoS One. 8:e78787(2013).