Stem-loop sequence pxy-mir-9a

AccessionMI0027371 (change log)
DescriptionPlutella xylostella miR-9a stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention pxy-mir-9a
(1 sentences)

Stem-loop
   gua      u   uaa   u       u        g     -  aa 
5'    guagau ggu   uua cuuuggu aucuagcu uauga gu  u
      |||||| |||   ||| ||||||| |||||||| ||||| ||  a
3'    uaucug ccg   aau gaggcca uggaucga auacu ca  u
   cug      -   -ug   u       u        a     a  ga 
Get sequence
Deep sequencing
385 reads, 1.04e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_42: 491913-492006 [-]
intergenic
Database links

Mature sequence pxy-miR-9a

Accession MIMAT0033776
Sequence

58 - 

uaaagcuagguuaccggaguu

 - 78

Get sequence
Deep sequencing125 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1