Stem-loop sequence pxy-mir-8532

AccessionMI0027372 (change log)
DescriptionPlutella xylostella miR-8532 stem-loop
Stem-loop
   guc                                acu 
5'    guccgucuagcgcggggcaucuugugucgaaa   a
      ||||||||||||||||||||||||||||||||    
3'    caggcggaucgugucucguagagcacagcuuu   c
   guc                                gac 
Get sequence
Deep sequencing
11 reads, 275 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_30: 78442-78519 [+]
intergenic
Database links

Mature sequence pxy-miR-8532-5p

Accession MIMAT0033777
Sequence

16 - 

cggggcaucuugugucgaaaacu

 - 38

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8532-3p

Accession MIMAT0033778
Sequence

44 - 

uuucgacacgagaugcucugug

 - 65

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1