Stem-loop sequence pxy-mir-8533

AccessionMI0027373 (change log)
DescriptionPlutella xylostella miR-8533 stem-loop
Literature search

1 open access papers mention pxy-mir-8533
(1 sentences)

Stem-loop
   guc    -  u       -  g  aa      a    a      aggg ga 
5'    guuu gu gugucga ug gc  gcccaa aucc cuagaa    c  g
      |||| || ||||||| || ||  |||||| |||| ||||||    |   
3'    caag ca cacagcu au cg  cggguu uagg gaucuu    g  a
   cau    u  u       c  g  cg      c    a      --aa aa 
Get sequence
Deep sequencing
23 reads, 600 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_2: 1896956-1897055 [-]
intergenic
Database links

Mature sequence pxy-miR-8533

Accession MIMAT0033779
Sequence

57 - 

uucuagaggaucuugggcgcgc

 - 78

Get sequence
Deep sequencing22 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1