Stem-loop sequence pxy-mir-8534

AccessionMI0027374 (change log)
DescriptionPlutella xylostella miR-8534 stem-loop
Literature search

1 open access papers mention pxy-mir-8534
(1 sentences)

Stem-loop
   -  g    a               c  aa   u ugc 
5'  gu ccca ugacggcaucggcag cu  uca g   u
    || |||| ||||||||||||||| ||  ||| |   a
3'  ca gggu acugccguagccguc ga  agu c   a
   c  -    g               u  --   c uaa 
Get sequence
Deep sequencing
11 reads, 400 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_4: 961737-961809 [-]
intergenic
Database links

Mature sequence pxy-miR-8534-5p

Accession MIMAT0033780
Sequence

9 - 

ugacggcaucggcagccuaau

 - 29

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8534-3p

Accession MIMAT0033781
Sequence

46 - 

gaagucugccgaugccgucagu

 - 67

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1