Stem-loop sequence pxy-mir-193

AccessionMI0027375 (change log)
DescriptionPlutella xylostella miR-193 stem-loop
Stem-loop
   -  g       cc     -au     -   gc    a   - ga     -aag         u   ga   u      -    g      c uu 
5'  gu uaguaua  ugucu   uucag ggu  cuuc uca u  cgagg    uccauccug ggc  ggg cuuagc gguc aguggg g  c
    || |||||||  |||||   ||||| |||  |||| ||| |  |||||    ||||||||| |||  ||| |||||| |||| |||||| |  c
3'  cg aucaugu  auaga   agguc uca  gaag agu g  gcuuc    agguggggc ccg  ccc gaaucg ccgg ucaucc c  c
   a  -       -u     agc     g   aa    -   c ag     gaua         u   aa   u      u    -      - uu 
Get sequence
Deep sequencing
13 reads, 325 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_523: 140581-140760 [+]
intergenic
Database links

Mature sequence pxy-miR-193

Accession MIMAT0033782
Sequence

63 - 

agggucuuagcggucgagugg

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1