Stem-loop sequence pxy-mir-8535-1

AccessionMI0027376 (change log)
DescriptionPlutella xylostella miR-8535-1 stem-loop
Gene family MIPF0002053; mir-8535
Stem-loop
   -  g                                 c    
5'  gu ucgcacggacugacugacaccaacuaucuacag uga 
    || ||||||||||||||||||||||||||||||||| || c
3'  cg agcgugccugacugacugugguugauagauguc aca 
   a  -                                 c    
Get sequence
Deep sequencing
30 reads, 750 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_229: 525677-525757 [+]
intergenic
Database links

Mature sequence pxy-miR-8535-5p

Accession MIMAT0033783
Sequence

14 - 

ugacugacaccaacuaucuaca

 - 35

Get sequence
Deep sequencing12 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8535-3p

Accession MIMAT0033784
Sequence

49 - 

uagauaguuggugucagucagu

 - 70

Get sequence
Deep sequencing42 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1