Stem-loop sequence pxy-mir-277

AccessionMI0027378 (change log)
DescriptionPlutella xylostella miR-277 stem-loop
Gene family MIPF0000156; mir-277
Literature search

1 open access papers mention pxy-mir-277
(2 sentences)

Stem-loop
   g          a  -          -            aagcacgcuacaaguuug 
5'  uucgccucgg gu ucgugccagg agugcguuugca                  c
    |||||||||| || |||||||||| ||||||||||||                   
3'  gagcggggcc ca agcauggucu ucacguaaaugu                  g
   u          c  c          a            cacaguugaaacguuauu 
Get sequence
Deep sequencing
47 reads, 1.2e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_443: 185665-185776 [+]
intergenic
Database links

Mature sequence pxy-miR-277

Accession MIMAT0033785
Sequence

77 - 

uaaaugcacuaucugguacgaca

 - 99

Get sequence
Deep sequencing39 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1